CBSE Class 12 Exam Analysis 2023 : Biology Analysis, Review & Question Paper with Answer Key

byBright Zoom •March 16, 2023

0

CBSE Class 12 Exam Analysis 2023 : Biology Analysis, Review & Question Paper with Answer Key

BRIGHT CBSE MASTER,

The Central Board of Secondary Education (CBSE) Class 12th Biology board exam 2023 was held today, 16th March 2023. The exam was 3 hours long and was conducted all over the country from 10.30 AM to 1.30 PM, with lakhs of students appearing and putting in their best efforts.

Biology is an important subject for science stream students, especially for medical science aspirants. Mastering CBSE Class 12 Biology is a must if you want to pursue a successful career as a doctor, nurse, scientist, forensic analyst etc.

As such, biology is a crucial exam, and most students want to know the difficulty level of the question paper and how they fared. In this article, we present a comprehensive 2023 CBSE Class 12 Biology exam review for students to judge their performance and get an idea of their expected scores. Check out the following sections to know more about the CBSE class 12 Biology exam analysis, question paper pdfs and answer key.

CBSE Class 12th Biology Question Paper With Answer Key - Set - 1 - 57/3/1

CBSE Class 12th Biology Question Paper With Answer Key - Set - 1 - 57/3/3

CBSE Class 12th Biology Question Paper With Answer Key - Set - 1 - 57/5/1

CBSE Class 12 Biology Exam Paper - Expert Review 2023

CBSE Class 12 Biology Paper 2023 is now over, and students had varying reactions. Some found it difficult while others barely felt any challenge. The Biology exam is always tricky due to the subject’s conceptual nature.
The questions asked in the 2023 CBSE 12th Biology Exam were mostly straightforward, and there was nothing too tricky except for a few questions, which happen every year.
The difficulty level of the CBSE Class 12 Biology Exam was moderate. Some students even found it easy.
According to our subject experts, section A consisting of MCQs and assertion-reason-based questions was the most scoring and easiest part of the exam. However, the difficulty level increased from there.
The short answer questions, especially the Section C was the most difficult part of the paper. The long-answer and case study based questions required out-of-the-box thinking but were manageable.
Per teachers, most questions were direct and simple and students who judiciously prepared from the NCERT books and sample papers will score highly.

CBSE Class 12 Biology Paper ‘balanced’, ‘highly-scoring MCQs’; Students, Teachers Analyse

“The difficulty level was same as that of CBSE sample paper. Students found assertion and reason questions a bit tricky, Section B, C and D were of moderate level, while Section E had majorly direct questions. Students who had thoroughly prepared from NCERT will score well, she added.

“The level of biology paper was moderate. MCQs were highly scoring, however few subjective questions were tricky and required critical thinking,” she added, saying that the paper was structured as per CBSE 2023 biology sample paper but the overall paper required technical thinking and application.

The multiple-choice questions in section A were easy
Section C had all the direct questions from NCERT and it is scoring
Both the case-based questions in section D were tricky
All the questions from section E were also direct.

Type Of Questions Asked In Today’s CBSE 12th Biology Exam

The CBSE Class 12 Biology exam consisted of 5 sections equaling 70 marks. The paper duration was 3 hours and candidates were provided 15 minutes to read the question paper.

CBSE 12th Biology Exam Pattern and Blueprint

Section A: 16 MCQ and Assertion-Reason type questions of 1 mark each.
Section B: 5 very short answer questions of 2 marks each.
Section C: 7 short answer questions of 3 marks each.
Section D: 2 case-based questions of 4 marks each.
Section E: 3 long answer questions of 5 marks each.

CBSE Class 12 Biology 2023 Answer Key - Code - 57/5/1

Section A

1. At what stage during evolution did humans use hides to protect their bodies and buried their dead?

A. Homo habilis

B. Neanderthal man

C. Java man

D. Homo erectus

Ans: B Neanderthal man

2.

Ans: d A - i, B - iii, C - iv, D - ii

3. The decrease in the T-lymphocytes count in human blood will result in:

(a) Decrease in antigens

(b) Decrease in antibodies

(c) Increase in antibodies

(d) Increase in antigens

Ans: (b) Decrease in antibodies

4. Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.

3' AUCAGGUUUGUGAUGGUACGA 5'

(a) Phenylalanine, Methionine
(b) Cysteine, Glycine
(c) Alanine, Proline
(d) Serine, Valine

Ans: c) Alanine, Proline

5. A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of

(a) Commensalism

(b) Parasitism

(c) Amensalism

(d) Mutualism

Ans: (d) Mutualism

6. Select the pathogen mismatched with the symptoms of disease caused by it from the list given below

(a) Entamoeba histolvtica : Constipation, abdominal pain.

(b) Epidermophyton : Dry scaly lesions on nail

(c) Wuchereria bancrofti : Chronic inflammation of lymphatic vessels of lower limb

(d) Haemophilus influenzae : Blockage of the intestinal passage.

Ans: (d) Haemophilus influenzae : Blockage of the intestinal passage.

7. The primary productivity in an ecosystem is expressed as :

(a) gm-2 yr-1

(b) gm-2 yr

(b) Kcal m-2 yr-1

(d) K cal m-2

Ans: (d) K cal m-2

8. Given below is the restriction site of a restriction endonuclease Pst-I and the cleavage sites on a DNA molecule. Choose the option that gives the correct resultant fragments by the action of the enzyme Pst-I.

Ans: d

9. The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including

(a) 330 invertebrates

(b) 338 invertebrates

(c) 359 invertebrates

(d) 362 invertebrates

Ans: (c) 359 invertebrates

10. Given below are the list of the commercially important products and their source organisms. Select the option that gives the correct matches.

List A	List B
Bioactive Products	Microbes (Source Organism)
(A) Cyclosporin A	(i) Streptococcus
(B) Statins	(ii) Tricoderma polysporum
(C) Streptokinase	(iii) Penicillium notatum
(D) Penicillin	(iv) Monascus purpureus

Options :

(a) (A)-(i), (B) -(ii), (C)-(iii), (D)-(iv)

(b) (A)-(iii), (B)-(iv), (C)-(ii), (D)-(i)

(c) (A)-(iv), (B)-(iii), (C)-(ii), (D)-(i)

(d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii)

Ans: (d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii)

11. Important attributes belonging to a population but not to an individual are

(i) Birth rate and death rate

(ii) Male and female

(iii) Birth and death

(iv) Sex-ratio

Select the correct option from the given options :

(a) (i) only

(b) (ii) only

(c) (ii) and (iii)

(d) (i) and (iv)

Ans: (d) (i) and (iv)

12. Select the option that shows the correctly identified 'U', X, Y and Z in a developing dicot embryo.(a) X-Plumule (2n), Y Suspensor (n), Z Cotyledon (2n), U- Radicle (2n).

(b) X-Plumule (2n), Y- Suspensor (2n), Z = Radicle (2n), U - Cotyledon (2n).

(c) X-Suspensor (2n), Y Cotyledon (2n), Z- Radicle (2n), U- Plumule (2n).

(d) X-Cotyledon (2n), Y- Radicle (n), Z-Plumule (n), U-Suspensor (n).

Answer: (d) X-Cotyledon (2n), Y- Radicle (n), Z-Plumule (n), U-Suspensor (n).

Section B

Question 17: The graph given below shows the number of primordial follicles per ovary in women at different ages. Study the graph and answer the questions that follow.

What is the average age of the women at the onset of menopause?
At what age are maximum primordial follicles present in the ovary, according to the given graph?

Ans:

50 years
10 years

Question 18: "Cattle and goats do not browse the Calotropis plant." Justify the statement giving reasons.

Ans: Organisms to survive in the complex food web have evolved characters to support their living and prevent them from predators. One of such example is Calotropis. Calotropis plant also known as milkweed produce a chemical compound cardiac glycoside that affect the mammalian heart. It is the defence mechanism in Calotropis plant to keep cattle stay away from it. This is the reason cattle and goats do not feed/browse on this plant.

Question 19: By using Punnett square depict the genotypes and phenotypes of test crosses (where green pod colour (G) is dominant over yellow pod colour (g)) in Garden pea with unknown genotype.

Ans: Test cross is a type of genetic cross which is used to know the genotype of an unknown organism. In this, unknown parent is crossed with a homozygous recessive parent.

Given:

Dominant allele: G
Dominant trait: Green pod color
Recessive allele: g
Recessive trait: yellow pod color

Condition 1:

Genotypic ratio: 100% heterozygous dominant i.e, 1:0 ratio

Phenotypic ratio: all green

Conculsion: Unknown is homozygous dominant

Condition 2:

Genotypic ratio: 50% heterozygous dominant and 50% heterozygous dominant i.e, 1:1 ratio

Phenotypic ratio: 50% Green: 50% Yellow

Conculsion: Unknown is heterozygous dominant

Condition 3:

Genotypic ratio: 100% recessive i.e, 1:0 ratio

Phenotypic ratio: all yellow

Conculsion: Unknown is homozygous recessive

Question 20:

a)

(i) Give an example of a genus of virus used as narrow spectrum insecticidal biocontrol agent.

(ii) How does its use serve as an aid in overall integrated pest management programme?

OR

b) Why a malignant tumour considered to be more damaging than a benign tumour? Explain.

Answer:

a)

i) Nucleopolyhedrovirus

ii) Baculoviruses are the viruses belong the genous These viruses attack the arthropods/insects. These viruses are excellent species specific effective narrow spectrum insecticidal biocontrol agent. This is especially important when treating an environmentally sensitive area or conserving beneficial insects to support an overall integrated pest management (IPM) programme.

b)

Tumours are the cellular mass that develop inside the body due to accumulation of cells or their over growth. These are divided into categories of benign and malignant tumours. Benign tumours are less harmful as compared to malignant tumours. It is because, malignant tumours have malignant property i.e, the cells of malignant tumours can detach from their main site and spread in other parts of the body. Thus, malignant tumours spread easily in the body. This leads to chances of cancer spread in the patient with malignant tumours.

Question 21:

(a) Write the scientific name of the source organism of the themostable DNA polymerase used in PCR.

(b) State the advantage of using Thermostable DNA polymerase.

Answer:

a) Thermus aquaticus

b) Thermostable polymerase (Taq polymerase) is used in the PCR due to their advantage to remain active at very high temperatures. Unlike other polymerases, Taq polymerase do not get dentaure in the process of PCR thus, effectively perform the task of DNA strand polymeriozation even at 94-95⁰C temperature.

Section C

Question 22: Name and explain a surgical contraceptive method that can be adopted by the male partner of a couple.

Answer:

The surgical contraceptive method adopted by the male partner is vasectomy.

In vasectomy a surgical expert cut the vas deferens and ties the ends to stop the transport of sperms from the epididymis to the ejaculatory duct. Thus, it ensures the absence of sperm in the male ejaculation to prevent unwanted pregnancies. This procedure is performed on both the vas deferens. It is an irreversible procedure thus, if the male partner wants to plan a baby with his partner can surgically eliminate this restriction.

Question 23: Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

(a) Enlist any four prime goals of HGP.

(b) Name any one common non-human animal model organism which has also been sequenced thereafter.

Answer:

a) (i) Identify all the approximately 20,000-25,000 genes in human DNA

(ii) Determine the sequences of the 3 billion chemical base pairs that make up human DNA

(iiii) Store this information in databases

(iv) Improve tools for data analysis

b) Caenorhabditis elegans (a free living non-pathogenic nematode)

-------------

CBSE Class 12th Hindi Core Question Paper With Answer Key

CBSE Class 12th Hindi Elective Question Paper With Answer Key